Skip to content

Advertisement

  • Research article
  • Open Access
  • Open Peer Review

Comparative study of bacteriological culture and real-time fluorescence quantitative PCR (RT-PCR) and multiplex PCR-based reverse line blot (mPCR/RLB) hybridization assay in the diagnosis of bacterial neonatal meningitis

  • 1Email author,
  • 1,
  • 1,
  • 1,
  • 1,
  • 1,
  • 2,
  • 3,
  • 1,
  • 1,
  • 2,
  • 4 and
  • 4
BMC Pediatrics201414:224

https://doi.org/10.1186/1471-2431-14-224

  • Received: 24 April 2014
  • Accepted: 26 August 2014
  • Published:
Open Peer Review reports

Abstract

Background

Bacterial meningitis is more common in the neonatal period than any other time in life; however, it is still a challenge for the evidence based diagnosis. Strategy for identification of neonatal bacterial meningitis pathogens is presented by evaluating three different available methods to establish evidence-based diagnosis for neonatal bacterial meningitis.

Methods

The cerebrospinal fluid samples from 56 neonates diagnosed as bacterial meningitis in 2009 in Beijing Children’s Hospital were analyzed in the study. Two PCR based molecular assays, real-time fluorescence quantitative PCR (RT-PCR) and multiplex PCR based-reverse line blot hybridization (mPCR/RLB), were used to assess 7 common neonatal meningitis bacterial pathongens, including Escherichia coli, Staphylococcus aureus, Listerisa monocytogenes, Neisseria meningitidis, Haemophilus influenzae, Streptococcus pneumoniae, and Streptococcus agalactiae. The findings in examinations of two assays were compared with the results obtained bacterial culture tests.

Results

Bacterial meningitis was identified in five cases (9%) by CSF cultures, 25 (45%) by RT-PCR and 16 (29%) by mPCR/RLB. One strain of S. epidermidis and one of E. faecalis were identified using mPCR/RLB but not by RT-PCR. In contrast, cultures identified one strain of S. pneumoniae which was missed by both PCR assays. Overall, the bacterial pathogens in 28 cases were identified with these three methods. Both RT-PCR and mPCR/RLB assays were more sensitive than bacterial culture, (p < 0.05).

Conclusion

Our study confirmed that both RT-PCR and mPCR/RLB assays have better sensitivity than bacterial culture. They are capable of detecting the pathogens in CSF samples with negative culture results.

Keywords

  • Neonate, Bacterial meningitis, Bacterial pathogens identification, Multiplex real-time fluorescence quantitative PCR (RT-PCR), Multiplex PCR based-reverse line blot hybridization (mPCR/RLB) assay
  • Bacteria culture

Background

Bacterial meningitis is more common in the neonatal period than any other time in life [14]. A recent review on neonatal infections reports that the incidence of meningitis ranges from 0.8 to 6.1 cases per 1,000 live newborns [5]. The World Health Organization (WHO) estimates that there are approximately 5 million neonatal deaths a year, and the fatality rate of neonatal meningitis is as high as 50% [6, 7]. The overwhelming majority (98%) of fatal cases of neonatal meningitis occurs in developing countries. Moreover, 21% to 50% of the survivors show neurological sequelae with hydrocephalus, blindness, hearing loss, paralysis, and mental retardation [4].

Signs and symptoms of neonatal bacterial meningitis may be subtle, nonspecific, vague, and atypical. A high index of suspicion is therefore needed to initiate investigations. Further, the identification of specific organisms and their sensitivity is important for the judicious and rational use of antimicrobial agents. No single cerebrospinal fluid (CSF) value can be used to exclude meningitis, and peripheral WBC counts are poor predictors of neonatal meningitis [8]. Currently, few techniques for the rapid diagnosis of neonatal bacterial meningitis are available, and the commercial molecular tests are generally too expensive for developing countries. The bacterial culture remains as the gold standard though there is low recovery rate of pathogens.

Non-culture methods, such as multiplex real-time fluorescence quantitative PCR (RT-PCR) and multiplex polymerase chain reaction (mPCR)-based reverse line blot (RLB) hybridization assays are reliable and accurate tests which could increase the diagnostic yield of bacterial meningitis [913]. Both RT-PCR and mPCR/RLB assays have been used as excellent tool in epidemiologic studies [14, 15]. The RT-PCR assay has characteristic of high sensitivity in CSF [10]; the mPCR/RLB approach is suited for the batched simultaneous analysis of large numbers of isolates [15].

The aim of this study was to evaluate the optimal strategy for identification of bacterial pathogens in neonatal bacterial meningitis based on the three methods including RT-PCR, mPCR/RLB and CSF bacterial culture.

Methods

Patient selection

This is a cross sectional design study. This study enrolled newborns with bacterial meningitis aged between 0 to 28 days admitted to the neonatal department in Beijing Children’s Hospital, affiliated to Capital Medical University in 2009. The bacterial meningitis was diagnosed based on clinical presentation, abnormal laboratory tests and CSF culture [16]. The diagnostic laboratory criteria for bacterial meningitis included the following: presence of >20 leukocytes/mm3, predominance of neutrophils; protein concentration in cerebrospinal fluid >150 mg/dL; hypoglycorrhachia <1.1-2.2 mmol/L or <50%-75% of the concomitant blood glucose concentration; identification of bacteria on microscopy and/or culture of eliminate CSF. The clinical manifestations suggestive of neonatal meningitis included lethargy, vomiting, convulsions, irritability, refuses to feed, tremors and bulging fontanels. The exclusion criteria consisted of central nervous system malformations, meningitis after cranio-encephalic trauma, and viral or fungal meningitis.

Our study was agreed by the Research Ethical Review Committee, Beijing Children’s Hospital Affiliated to Capital Medical University. The written consent informs were obtained from the parents of all participants.

CSF samples

The initial CSF samples were used for analysis, which were collected by an experienced physician under aseptic condition. The volume, turbidity, cells, protein and glucose concentration of CSF samples were measured. 100 μl of CSF was inoculated onto each bacterial culture plate. The remaining samples were placed into two sterile tubes, (0.5-1 ml), and stored at −70°C.

Bacterial isolates

Reference strains of 7 bacterial species - Escherichia coli, Staphylococcus aureus, Listerisa monocytogenes, Neisseria meningitidis, Haemophilus influenzae, Streptococcus pneumoniae, and Streptococcus agalactiae, as listed in Table 1, were used to develop the assays. RT-PCR and mPCR/RLB were developed to detect the target genes of the specific pathogens from prior clinical isolates. All clinical isolates were identified according to conventional standard methods.
Table 1

Bacterial species and isolates used to develop and evaluate the RT-PCR, mPCR/RLB and DNA detection limits for each species

Species

Strain ID number

RT-PCR

mPCR/RLB

Clinical isolates (No)

Target gene

Detection limit

Genome copies/μL

Target gene

Detection limit

Genome copies/μL

E. coli

ATCC 25922

16S rRNA

2 fg

0.3

16S rRNA

500 fg

90

6

S. aureus

ATCC 25923

femA

200 fg

63

nuc

500 fg

160

9

L. monocytogenes

ATCC 19112

hly

200 fg

62

hly

50 fg

15

2

N. meningitides

ATCC 29019

ctrA

20 fg

8

ctrA

500 fg

200

2

S. pneumoniae

SSI serotype 14

lytA

200 fg

90

ply

500 fg

230

7

H. influenza

ATCC 10211

bexA

20 fg

10

gyrB

500 fg

255

10

S. agalactiae

ATCC A2

cfb

200 fg

91

cfb

500 fg

228

5

Abbreviations: ATCC – American Type Culture Collection.

Genome copies/μl = concentration (ng/μl) × 6.02 × 1023 × 10−9/660× whole genome nucleotide number. The number of whole-genome nucleotide: E. coli-5498450-bp, S. aureus-2902619-bp, L. monocytogenes-2944528-bp, N. meningitides-2194961-bp, S. pneumonia e −2046115-bp, H. influenza-1830138-bp, S. agalactiae −2160267-bp.

DNA extraction

DNA extraction was performed using QIAGEN QIAamp DNA Blood mini kit (QIAGEN, Shanghai, China) following the product instruction. An aliquot of 200 μL of CSF was processed and the DNA was eluted in 100 μL of TE buffer.

RT-PCR

A RT-PCR assay on Mx3000P QPCR Systems (Stratagene, USA) was used to identify seven common pathogens that cause neonatal bacterial meningitis.

Primer and probe design

Species-specific primers and probes were designed, followed previously validated methods, to allow amplification [1721]. The details of the primers and the probes in this assay are shown in Table 2.
Table 2

Primers and probes used in RT-PCR assay

Specificity

Target

 

Primer and probe sequence (5′- 3′)

Application product (bp)

E.coli

16S rRNA

F

GGGAGTAAAGTTAATACCTTTGC

204

R

CTCAAGCTTGCCAGTATCAG

Probe

FAM-CGCGATCACTCCGTGCCAGCAGCCGCGGATCGCG-BHQ1

L.monocytogenes

hly

F

CAT GGCACCACCAGC ATCT

64

R

ATC CGCGTGTTTCTTTTCGA

Probe

HEX-CGCCTG CAA GTC CTA AGA CGC CA-BHQ1

S. aureus

femA

F

TGCTGGTGGTACATCAAA

97

R

ACGGTCAATGCCATGATTTAA

Probe

FAM-ATTTTGCCGGAAGTTATGCAGTGCAATG-BHQ1

N. meningitidis

ctrA

F

TGTGTTCCGCTATACGCCATT

114

R

GCCATATTCACACGATATACC

Probe

FAM-AACCTTGAGCAA“T”CCATTTATCCTGACGTTCT-SpC6 “T”-BHQ1

H. influenzae

bexA

F

TGCGGTAGTGTTAGAAAATGGTATTATG

116

R

GGACAAACATCACAAGCGGTTA

Probe

HEX-ACAAAGCGTATCAA“T”ACTACAACGAGACGCAAAAA-SpC6 “T”-BHQ

S. pneumoniae

lytA

F

ACGCAATCTAGCAGATGAAGCA

75

R

TCGTGCGTTTTAATTCCAGCT

Probe

FAM-TGCCGAAAACGCTTGATACAGGGAG-BHQ1

S. agalactiae

cfb

F

CGCAATGAAGTCTTTAATTTTTC

260

  

R

ATGATGTATCTATCTGGAACTCTAGTG

 
The assays were carried out in a final 20 μL reaction volume and were performed using 2 × PCR Premix Ex Taq (Stratagene, USA), with 2 μL of sample extracted DNA. Forward primer, reverse primer, and probe for each gene target were mixed. The probes were labeled at the 5′ end with FAM and HEX, respectively. RT-PCR was performed at 95°C for 2 min, followed by 35–50 cycles of 95°C for 5 sec and 60-73°C for 20 sec (see Table 3 for detail).
Table 3

Thermal profiles of RT-PCR

Specificity

Thermal profiles

N. meningitides

95°C for 2 min, followed by 50 cycles of 95°C for 5 sec and 60°C for 20 sec

S. aureus

H. influenzae

S. pneumoniae

L.monocytogenes

95°C for 2 min, followed by 50 cycles of 95°C for 5 sec and 63°C for 20 sec

E.coli

95°C for 30 sec, followed by 50 cycles of 95°C for 15 sec, 50°C for 30 sec and 75°C 20s

S. agalactiae

95°C for 30 sec, followed by 35 cycles of 94°C for 10 sec, 60°C for 15 sec and 72°C for 25s

Analytical sensitivity and specificity

DNA was extracted from reference strains using a DNA Miniprep Extraction kit (Sigma, St Louis, MO, USA) according to the manufacturer’s instructions, and was tested against all primer sets. The lower limit of detection (LLD) was determined using extracted DNA from one isolate each of E. coli, S. aureus, L. monocytogenes, N. meningitidis, S. pneumoniae, H. influenzae, and group B streptococci. DNA concentration was adjusted to 100 ng/mL from which serial ten-fold dilutions of genomic DNA were prepared in distilled water. In addition, serial ten-fold dilutions of suspensions of cultures of seven bacteria were prepared in physiological saline. Crude DNA was extracted from 1 mL of these suspensions being heated to 100°C for 10 min.

mPCR/RLB

The mPCR/RLB assay was used to identify the seven pathogens, same as shown in Table 1.

Primer and probe design

Species-specific primers and probes were designed, based on a previously validated method [4]. Primers were labeled at the 5′end with biotin to allow PCR products to be detected by hybridization with a streptavidin–peroxidase substrate in the RLB assay. All probes were labeled at the 5′end with an amine group to facilitate covalent linkage to nylon membranes and to allow membranes to be stripped and reused repeatedly.

mPCR/RLB

The mPCR mixture containing 14 primer-pairs included 5 μL DNA extract, 0.25 μL each forward (50 umol/L) and reverse (50 μmol/L) primer, 1.25 μL dNTPs mix (2.5 mM each dNTP), 2.5 μl 10 × PCR buffer, 4.5 mM MgCl2 (final concentration), 3uL Hotstar Taq DNA polymerase (Qiagen, Shanghai, China) and water to 25 μL. mPCR was performed in single tube at 95°C for 15 min, followed by 35 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 1 min, finally by 72°C for 10 min. The development of RLB hybridization assay was described in previous studies [14].

Analytical specificity and sensitivity for mPCR/RLB

Extraction of DNA and adjustment of DNA concentration were performed with same operations as RT-PCR. In addition, serial ten-fold dilutions (starting at 105 CFU/mL) of suspensions of cultures of Escherichia coli ATCC 25922 and Streptococcus pneumoniae SSI 14 were prepared in physiological saline.

Statistical analysis

Statistical analyses were performed using the SPSS 19.0 software. Chi squared test was used to compare to the sensitivity of identified pathogens by assay and CSF cultures. A P-value of < 0.05 (2-tailed) was considered as significance.

Results

General clinical characteristics

56 infants were enrolled in the study. The written informed consent was obtained from the parents of all participants. The clinical characteristics of the 56 infants are shown in Table 4.The mean gestational age (GA) of infants was 38 weeks. The mean birth weight was 3.10 kg and 64% of them were male. The majority (73%) of the infants presented clinical symptoms after 1 week of life. Most (91%) of the infants had fever. Thirty-six infants (68%) had been treated with antimicrobials before hospitalization.
Table 4

Characteristics of 56 neonatal infants

Gestational age (week)

 

 <37

5 (9%)

 37-42

51 (91%)

Gender

 

 Male

36 (64%)

 Female

20 (36%)

Onset

 

 Early (<1 week)

15 (27)

 Late (>1 week)

41 (73)

Antibiotics before hospitalization

 

 Yes

36 (64%)

 No

20 (36%)

Syptoms

 

 fever

51 (91%)

 Jaundice

23 (41%)

 convulsion

10 (18%)

Signs

 

 Bulging fontanelle

21 (38%)

 Limb muscle tension change

14 (25%)

Results of laboratory test of the 56 infants are shown Table 5. The initial median WBC was 18.03 × 109/L, and 34 of the infants (61%) had leukocytosis with > 15 × 109/L. CRP was elevated in 21cases (>8 mg/L).
Table 5

Laboratory data of 56 neonatal infants

Characteristics

All patients (n = 56)

Blood

 

Peripheral white cell count

 

 (×109/l)

22 (39%)

 0-

34 (61%)

 15-

 

Serum C-reaction protein (mg/l)

 

 0-8

35 (63%)

 >8

21 (38%))

CSF

 

WBC count ( ×10 6 /L )

 

 0-

10 (18%)

 21-

18 (32%)

 >100

28 (50%)

Glucose (mmol/l)

 

 0-2.2

34 (61%)

 >2.2

22 (39%)

Protein (mg/l)

 

 204-1000

26 (46%)

 1001-2000

21 (38%)

 >2000

9 (16%)

CSF culture positive

5 (9%)

Clinical microbiology

Five CSF (9%) bacterial cultures were positive: two L. monocytogenes, one each of S. pneumoniae, E. faecalis, and S. epidermidis, respectively. Bacteria were isolated from blood cultures of nine patients (16%).

Primers and probes

Target genes for each species, primer/probe sequences, and specificities, locations within target genes, numbered base positions and melting temperatures (Tm) are shown in Table 6.
Table 6

Primers and probes used in mPCR/RLB assay.

Specificity

Primer/probe

Target

Tm (°C)

GenBank accession No.

Primer and probe sequence (5′-3′)

Application product (bp)

S. aureus

SanucSb

nuc

65.68

V01281

GCG ATT GAT GGT GAT ACG GTT

278

S. aureus

SanucAb

nuc

69.12

V01281

AGC CAA GCC TTG ACG AAC TAA AGC

S. aureus

SanucSp

nuc

61.06

V01281

GAT GGA AAA ATG GTA AAC GAA G

S. aureus

SanucAp

nuc

61.36

V01281

CAT TGG TTG ACC TTT GTA CAT TAA

S. pneumoniae

SpplySb

ply

67.47

M17717

CCC ACT CTT CTT GCG GTT GA

208

S. pneumoniae

SpplyAb

ply

61.68

M17717

TGA GCC GTT ATT TTT TCA TAC TG

S. pneumoniae

SpplySp

ply

65.44

M17717

CCC AGC AAT TCA AGT GTT CG

S. pneumoniae

SpplyAp

ply

65.49

M17717

CCA CTT GGA GAA AGC TAT CGC T

L.monocytogenes

LmhlySb

hly

67.37

M24199

CAT GGC ACC ACC AGC ATC T

135

L.monocytogenes

LmhlyAb

hly

63.8

M24199

CAC TGC ATC TCC GTG GTA TAC TAA

L.monocytogenes

LmhlySp

hly

68.2

M24199

GAA AAG AAA CAC GCG GAT GAA ATC

L.monocytogenes

LmhlyAp

hly

65.33

M24199

TGG CGT CTT AGG ACT TGC AG

S. agalactiae

GBScfbSb

cfb

59.53

X72754

ATG ATG TAT CTA TCT GGA ACT CTA GTG

259

S. agalactiae

GBScfbAb

cfb

60.48

X72754

CGC AAT GAA GTC TTT AAT TTT TC

S. agalactiae

GBScfbSp

cfb

59.74

X72754

ATC AAA GAT AAT GTT CAG GGA AC

S. agalactiae

GBScfbAp

cfb

58.55

X72754

TAC TTC TAA TAC AGC TGG TGA AAA

N. meningitidis

NmctrASb

ctrA

66.14

AF520909

GCT GCG GTA GGT GGT TCA A

110

N. meningitidis

NmctrAAb

ctrA

66.36

AF5209

TTG TCG CGG ATT TGC AAC TA

N. meningitidis

NmctrASp

ctrA

64.1

AF5209

ACG AAC TGT TGC CTT GGA AG

N. meningitidis

NmctrAAp

ctrA

63.76

AF5209

ATT GCC ACG TGT CAG CTG

H. influenzae

HigyrBSb

gyrB

62.57

U32738

GAA GCA CAG TCA TAA TAA CTT CTG CT

233

H. influenzae

HigyrBAb

gyrB

63.68

U32738

AGC GTC CTG GTA TGT ATA TCG G

H. influenzae

HigyrBSp

gyrB

62.96

U32738

TTG CAC CGA TAC AGA ATT ATC ATC

H. influenzae

HigyrBAp

gyrB

63.57

U32738

CGG GAT TCC TGT GGA TAT TC

E.coli

Ecoli16SSb

16SrRNA

65.74

J01859

ATG CCG CGT GTA TCA AGA A

93

E.coli

Ecoli16SAb

16SrRNA

68.03

J01859

TAA CGT CAA TGA GCA A

E.coli

Ecoli16SSp

16SrRNA

65.93

J01859

GGG GAG GAA GGG AGT AAA GT

E.coli

Ecoli16SAp

16SrRNA

63.71

J01859

AGT ACT TTA CAA CCC GAA GGC

Results of the RT-PCR and mPCR/RLB analysis

The criteria for positive diagnostic hybridization was that at least one species-specific oligonucleotide probe gave a positive signal. Detection limits of the RT-PCR analysis varied among the 7 reference strains, from 2 to 200 fg of genomic DNA and mPCR/RLB from 50 to 500 fg of genomic DNA (Table 1). The sensitivity of the assay was from 0.3 to 91 cfu/μL for RT-PCR assay, and from 15 to 255 cfu/μL for mPCR/RLB assay (Table 1). None of the species-specific probes cross-reacted with any non-target species among the reference strains or clinical isolates (Figure 1 Detection of 16 standard strains using the mPCR/RLB assay).
Figure 1
Figure 1

Detection of 16 standard strains using the mPCR/RLB assay.

Detection of potential pathogens in CSF by RT-PCR and mPCR/RLB assays

Positive RT-PCR findings were detected in 25 of 56 CSF, including E. coli (10), S. aureus (7), S. pneumonia (3), L. monocytogenes (2), group B streptococci (2), and N. meningitidis (1).

16 CSF specimens of 56 cases were identified with positive mPCR/RLB, which consisted of E. coli (6), S. aureus (2), L. monocytogenes (2), group B streptococci (2), S. pneumonia (1), and N. meningitides (1). Two positive results by this assay required further analysis to be identified as S. epidermidis and E. faecalis.

Comparison of RT-PCR assay with mPCR/RLB assay and CSF bacterial cultures

Overall, there were 28 cases with positive finding with these three test methods (bacterial culture, RT-PCR mPCR), indicating presence of pathogens. In one case, S. pneumonia was positive by culture only and negative by assay analysis. In two other cases, culture and mPCR/RLB were positive (S. epidermidis and E. faecalis), but the RT-PCR assay was negative. Biostatistics results are shown in Tables 7, 8 and 9. In brief, both RT-PCR and mPCR/RLB assays were more sensitive than bacterial culture in identification of pathogens, (p < 0.05), in addition, RT-PCR is more sensitive than mPCR/RLB assays (p < 0.05).
Table 7

Comparison of Results of RT-PCR and mPCR/RLB Clinical Specimens

 

RT-PCR (N = 56)

Total

+

-

mPCR/RLB

+

14 (25.0%)

2 (3.6%)

16 (28.6%)

-

11 (19.6%)

29 (51.8%)

40 (71.4%)

Total

 

25 (44.6%)

31 (55.4%)

56

Table 8

Comparison of Results of RT-PCR and cultures

 

Cultures(N = 56)

Total

+

-

RT-PCR

+

2 (3.5%)

23 (41.1%)

25(44.6%)

-

3 (5.4%)

28 (50.0%)

31 (55.4%)

Total

 

5(8.9%)

51(91.1%)

56

χ 2  = 13.885, P < 0.05.

Table 9

Comparison of Results of mPCR/RLB and cultures

 

Cultures (N = 56)

Total

+

-

mPCR/RLB

+

4 (80.0%)

12 (23.5%)

16 (28.6%)

-

1 (20.0%)

39 (76.5%)

40 (71.4%)

Total

 

5 (8.9%)

51 (91.1%)

56

χ 2  = 7.092, P < 0.05

Discussion

It is critical important for rapid and specific identification of the causative agent in CSF and decision of optimal therapy in the clinical management of neonatal bacterial meningitis. CSF culture is routine laboratory tool and current gold standard for the diagnosis of neonatal bacterial meningitis in clinical practice. However, there are only small amount of positive CSF culture in the samples of neonatal bacterial meningitis [22]. Therefore, it would be diagnostic dilemma for the patients with negative CSF culture. Another disadvantage of CSF culture is that it needs up to 72 h for final identification.

Molecular methods, including RT-PCR and mPCR/RLB, do not depend on the presence of viable or growing bacteria, and thus are suitable to the detection of pathogens that cannot be cultured readily by routine methods, or that have been partially killed by exposure to antibiotics [6]. Our study shows RT-PCR and mPCR could be used for the identification of usual pathogens that cause meningitis in the newborn period. Both RT-PCR and mPCR/RLB are more rapid than culture [23]; RT-PCR can generally be completed two to three hours, and seven hours for mPCR/RLB. The consumable cost of RT-PCR and mPCR/RLB (U$ 20/specimen and U$ 7/specimen respectively) is more expensive than the culture with which cost of U$ 2/specimen.

mPCR/RLB assay, a molecular diagnostic tool, is based on the use of primers and probes that recognize conserved species-specific sequences of bacterial genes encoding essential molecules [17]. In this study, none of the species-specific probes cross-reacted with any non-target species among the reference strains or clinical isolates suggested its high specificity because using two probes for each target. Analysis of amplicons in the mPCR/RLB assay is more sensitive and faster than cultures, and 101 to 102 times more sensitive than common PCR [17]. A particular advantage of mPCR/RLB is that the membranes can also be stripped and re-used up to 20 times without substantial loss of sensitivity [9]. The mPCR/RLB method is potentially suitable for use with large numbers of specimens – like retrospective investigation and epidemiological surveillance, as it can analyze 43 clinical samples simultaneously.

In this study, 38 (68%) patients had been treated with antimicrobials before hospitalization, which could contributed to the low yield from CSF 6 (11%) and blood 9 (16%) cultures. At least one pathogen was identified in 16 (29%) of patients by using of mPCR/RLB and 25 (45%) by RT-PCR, respectively. This indicates that mPCR/RLB and RT-PCR (in particular) is significantly more sensitive than culture.

In this study, there was better correlation between culture and mPCR/RLB than the RT-PCR assay. RT-PCR failed to identify some specimens (S. epidermidis and E. faecalis) that were positive by culture and mPCR/RLB, which may be related with lack of corresponding RT-PCR primers and probes. In one case, mPCR/RLB did not identify S. pneumoniae, which grew on culture. This result may reflect inappropriate long term stored specimens (as a retrospective study), and/or the presence of mutations in the target regions of probes. The agreement between the two molecular methods was good. Overall, RT-PCR was relatively easy to perform and more sensitive than mPCR/RLB, suggesting that it is a useful tool for the diagnosis of bacterial meningitis. This is thought to be due to either (a) the presence of mutations in the target regions of probes or (b) competition among the 7 primer pairs in mPCR/RLB.

In this study, the most common pathogen was Escherichia coli, followed by Staphylococcus aureus, which is similar to the result reported by Airede [23].

Our study demonstrates that the RT-PCR and mPCR/RLB have the potential to identify pathogens better than bacterial culture in the cases with bacterial meningitis. Further studies will use RT-PCR and mPCR/RLB in larger population with bacterial meningitis in future, especially for the cases with negative CSF culture or other bacterial pathogens.

Conclusion

RT-PCR and mPCR/RLB assays are potentially useful and reliable tools for the identification of neonatal bacterial meningitis. Both methods were found to be much more sensitive than culture particularly in the current series in which 68% of subjects had prior exposure to antibiotics. They detected the presence of pathogens in CSF samples that yield negative culture results. Further studies are necessary to confirm their utility and efficacy in optimizing the diagnosis and treatment of bacterial meningitis in young children.

Declarations

Acknowledgements

The study received funding from Capital Medical Development Research Foundation (No. 2009–2078), and Capital health system of high-level technical personnel training program (No. 2009-3-41). We are grateful to Helen M. Towers MD (New York - Presbyterian Morgan Stanley Children’s Hospital, New York, USA) who kindly reviewed this paper.

Authors’ Affiliations

(1)
Neonatal Center, Beijing Children’s Hospital, Capital Medical University, Beijing, 100045, China
(2)
Laboratory of Microbiology and Immunology, Beijing Children’s Hospital, Capital Medical University, Beijing, 100045, China
(3)
Chinese Center for Disease Control and Prevention, Beijing, China
(4)
Center for Infectious Diseases and Microbiology (CIDM), Institute of Clinical, Pathology and Medical Research (ICPMR), Westmead, New South Wales, Australia

References

  1. de Louvois J, Blackbourn J, Hurley R, Harvey D: Infantile meningitis in England and Wales: a two year study. Arch Dis Child. 1991, 66: 603-607. 10.1136/adc.66.5.603.View ArticlePubMedPubMed CentralGoogle Scholar
  2. Klein JO, Feigin RD, McCracken GH: Report of the task force on diagnosis and management of meningitis. Pediatrics. 1986, 78: 959-982.PubMedGoogle Scholar
  3. Overall JC: Neonatal bacterial meningitis. Analysis of predisposing factors and outcome compared with matched control subjects. J Pediatr. 1970, 76: 499-511. 10.1016/S0022-3476(70)80399-7.View ArticlePubMedGoogle Scholar
  4. Furyk JS, Swann O, Molyneux E: Systematic review: neonatal meningitis in the dev eloping world. Trop Med Int Health. 2011, 16: 672-679. 10.1111/j.1365-3156.2011.02750.x.View ArticlePubMedGoogle Scholar
  5. Thaver D, Zaidi AK: Burden of neonatal infections in developing countries: a review of evidence from community-based studies. Pediatr Infect Dis J. 2009, 28 (Suppl): S3-S9.View ArticlePubMedGoogle Scholar
  6. World Health Organization Young Infants Study Group: Clinical prediction of serious bacterial infections in young infants in developing countries. Pediatr Infect Dis J. 1999, 188 (10 Suppl): S23-S31.Google Scholar
  7. Weber MW, Carlin JB, Gatchalian S, Lehmann D, Muhe L, Mulholland EK: WHO Young Infants Study Group. Predictors of neonatal sepsis in developing countries. Pediatr Infect Dis J. 2003, 22: 711-717. 10.1097/01.inf.0000078163.80807.88.View ArticlePubMedGoogle Scholar
  8. Garges HP, Moody MA, Cotten CM, Smith PB, Tiffany KF, Lenfestey R, Li JS, Fowler VG, Benjamin DK: Neonatal meningitis: what is the correlation among cerebrospinal fluid cultures, blood culture, and cerebrospinal fluid parameters?. Pediatrics. 2006, 117: 1094-1100. 10.1542/peds.2005-1132.View ArticlePubMedGoogle Scholar
  9. Corless CE, Guiver M, Borrow R, Edwards-Jones V, Fox AJ, Kaczmarski EB: Simultaneous detection of Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae in suspected cases of meningitis and septicemia using real-time PCR. J Clin Microbiol. 2001, 39: 1553-1558. 10.1128/JCM.39.4.1553-1558.2001.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Chanteau S, Sidikou F, Djibo S, Moussa A, Mindadou H, Boisier P: Scaling up of PCR-based surveillance of bacterial meningitis in the African meningitis belt: indisputable benefits of multiplex PCR assay in Niger. Trans R Soc Trop Med Hyg. 2006, 100: 677-680. 10.1016/j.trstmh.2005.09.006.View ArticlePubMedGoogle Scholar
  11. Afifi S, Wasfy MO, Azab MA, Youssef FG, Pimentel G, Graham TW, Mansour H, Elsayed N, Earhart K, Hajjeh R, Mahoney F: Laboratory-based surveillance of patients with bacterial meningitis in Egypt (1998–2004). Eur J Clin Microbiol Infect Dis. 2007, 26: 331-340. 10.1007/s10096-007-0280-x.View ArticlePubMedGoogle Scholar
  12. Pedro LG, Boente RF, Madureira DJ, Matos JA, Rebelo CM, Igreja RP, Barroso DE: Diagnosis of meningococcal meningitis in Brazil by use of PCR. Scand J Infect Dis. 2007, 39: 28-32. 10.1080/00365540600904761.View ArticlePubMedGoogle Scholar
  13. Wang X, Mair R, Hatcher C, Theodore MJ, Edmond K, Wu HM, Harcourt BH, Carvalho Mda G, Pimenta F, Nymadawa P, Altantsetseg D, Kirsch M, Satola SW, Cohn A, Messonnier NE, Mayer LW: Detection of bacterial pathogens in Mongolia meningitis surveillance with a new real-time PCR assay to detect Haemophilus influenzae. Int J Med Microbiol. 2011, 301: 303-309. 10.1016/j.ijmm.2010.11.004.View ArticlePubMedGoogle Scholar
  14. Saha SK, Darmstadt GL, Yamanaka N, Billal DS, Nasreen T, Islam M, Hamer DH: Rapid diagnosis of pneumococcal meningitis: implications for treatment and measuring disease burden. Pediatr Infect Dis J. 2005, 24: 1093-1098. 10.1097/01.inf.0000190030.75892.78.View ArticlePubMedGoogle Scholar
  15. Xiao M, Guo LN, Kong F, Wang H, Sorrell TC, Li RY, Jiang W, Chen SC, Xu YC: Practical identification of eight medically important Trichosporon species byreverse line blot hybridization (RLB) assay and rolling circle amplification (RCA). Med Mycol. 2013, 51: 300-308. 10.3109/13693786.2012.723223.View ArticlePubMedGoogle Scholar
  16. Gleason CA, Devaskar S: Avery’s Diseases of the Newborn. 2011, Harcourt Asia: W.B.Saunders, 9Google Scholar
  17. Wang Y, Kong F, Gilbert GL, Brown M, Gao W, Yu S, Yang Y: Use of a multiplex PCR-based reverse line blot (mPCR/RLB) hybridization assay for the rapid identification of bacterial pathogens. Clin Microbiol Infect. 2008, 14: 155-160.View ArticlePubMedGoogle Scholar
  18. Penders J, Vink C, Driessen C, London N, Thijs C, Stobberingh EE: Quantification of Bifidobacterium spp., Escherichia coli and Clostridium difficile in faecal samples of breast-fed and formula-fed infants by real-time PCR. FEMS Microbiol Lett. 2005, 243: 141-147. 10.1016/j.femsle.2004.11.052.View ArticlePubMedGoogle Scholar
  19. Mothershed EA, Sacchi CT, Whitney AM, Barnett GA, Ajello GW, Schmink S, Mayer LW, Phelan M, Taylor TH, Bernhardt SA, Rosenstein NE, Popovic T: Use of real-time PCR to resolve slide agglutination discrepancies in serogroup identification of Neisseria meningitides. J Clin. Microbiol. 2004, 42: 320-328. 10.1128/JCM.42.1.320-328.2004.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Kong F, Gowan S, Martin D, James G, Gilbert GL: Serotype identification of group B streptococci by PCR and sequencing. J Clin Microbiol. 2002, 40: 216-226. 10.1128/JCM.40.1.216-226.2002.View ArticlePubMedPubMed CentralGoogle Scholar
  21. BergeronMG KD: Molecularmethods for rapid detection of group B streptococci. Expert Rev Mol Diagn. 2001, 1: 175-181. 10.1586/14737159.1.2.175.View ArticleGoogle Scholar
  22. Meyer T, Franke G, Polywka SK, Lütgehetmann M, Gbadamosi J, Magnus T, Aepfelbacher M: Improved detection of bacterial central nervous system infections using a broad-range PCR assay. J Clin Microbiol. 2014, 52: 1751-1753. 10.1128/JCM.00469-14.View ArticlePubMedPubMed CentralGoogle Scholar
  23. Airede KI, Adeyemi O, Ibrahim T: Neonatal bacterial meningitis and dexamethasone adjunctive usage in Nigeria. Niger J Clin Pract. 2008, 11: 235-245.PubMedGoogle Scholar
  24. Pre-publication history

    1. The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2431/14/224/prepub

Copyright

© Wang et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement