Skip to main content

Table 1 Design of the one-step triplex qRT-PCR assays for the detection of RSV, hMPV and Internal Control

From: Simultaneous detection of respiratory syncytial virus and human metapneumovirus by one-step multiplex real-time RT-PCR in patients with respiratory symptoms

Virus Target gene Name of primer or probe Sequence (5′ → 3′) Position
RSV Nucleoprotein RSV-F TGATACACTSAACAAAGATCAACTTCTG 27–54a
RSV-R TCTCCTGTGCTMCGTTGRAT 73–92a
RSV-probe VIC-CATCCAGCAAATACAC-MGBNFQ 56–71a
hMPV Fusion protein hMPV-F TCAGAATGCAGGGTCAACTGTT 156–177b
hMPV-R GACATGGTCTCCTCTTGTTTCACA 199–222b
hMPV-probe FAM-CAAGCTTCCCGTTCTCAGCC-MGBNFQ 179–197b
Internal Control GAPDH GAPDH-F GAAGGTGAAGGTCGGAGTC 108–126c
GAPDH-R GAAGATGGTGATGGGATTTC 314–333c
GAPDH-probe NED-CAAGCTTCCCGTTCTCAGCC-MGBNFQ 285–304c
  1. aGenBank Accession no. DQ780565.1
  2. bGenBank Accession no. AY295956.1
  3. cGenBank Accession no. NM_002046
\