Table 2 Sequences of oligonucleotide primers used for the amplification of HCMV genome
From: Human Cytomegalovirus: detection of congenital and perinatal infection in Argentina
Primers | Sequence (5-3)' | Product Length (pb) | Position in the gene | References |
|---|---|---|---|---|
IE | tgaggataagcgggagatgt | 242 | 1729–1748 | Jiwa N et al. (1989) |
actgaggcaagttctgcagt | 1951–1970 | |||
gB | Outer | |||
accaccgcactgaggaatgtcag | 150 | 1942–1966 | Darlington et al. (1985) | |
tcaatcatgcgtttgaagaggta | 2067–2091 | |||
inner | ||||
accaccgcactgaggaatgtcag | 100 | 1967–1989 | ||
tcaatcatgcgtttgaagaggta | 2066–2040 | |||
LA | cacctgtcaccgctgctatatttgc | 400 | 1967–1989 | Demmler G et al. (1998) |
caccacgcagcggcccttgatgttt | 2066–2040 |