Skip to main content

Table 2 Primers used for LAMB2 and NPHP1

From: Simultaneous mutations of LAMB2 and NPHP1genes in a Chinese girl with isolated congenital nephrotic syndrome: a case report

Gene Primer name Sequence (5'-3') Size (bp)
LAMB2 Primer 9F CTGGCATCTGGCAATGTGAGTG 390
Primer 9R AGCGACCACCGTCTTGAGAAC
Primer 29F TACAGGCAGCACTGGAGGA 441
Primer 29R GGTTAGGTTAGCGTGGTAGC
NPHP1 Primer 8F AATAGGATGGAGACTGTGGAAGA 560
Primer 8R CCTGTCACTCATGCTCTGGA
Primer17F TCAGGACTTATTCCAGGTCTGTCA 587
Primer17R GCACATAAGGAAGTGGCAAAGC