Skip to main content

Table 1 Primers used for amplification and sequencing of the coding and promoter’s regions of the UGT1A1 gene

From: Crigler-Najjar syndrome type II in a Chinese boy resulting from three mutations in the bilirubin uridine 5′-diphosphate-glucuronosyltransferase (UGT1A1) gene and a family genetic analysis

UGT1A1region Forward primer (5′ → 3′) Reverse primer (5′ → 3′)
Promoter & Exon 1 GAAACCTAATAAAGCTCCACCTTC TTGCTCAGCATATATCTGGGGC
Exon 2 TCATTTAAAGGGACCACGCC GGAAAAGCCAAATCTAAGGTTCC
Exon 3 & Exon 4 ACGTAGTGCATACACCCTTG GAAACAACGCTATTAAATGCTACG
Exon 5 GAAACAGGTTTCCTTTCCCAAG CAGAGGGGGCACGATACATA