Skip to main content

Table 1 Summary of primer sequences used PCR amplifications

From: Increased IL-4 mRNA expression and poly-aromatic hydrocarbon concentrations from children with asthma

Primers for humans Sequences Product size
GAPDH-F GAAGGTGAAGGTCGGAGTC 226
GAPDH-R GAAGATGGTGATGGGATTTC
IL-4-F CACA ACTGAGAAGGAAACCTTC TG 253
IL-4-R CTCTCTCATGATCGTCTT TAGCCT TTC
IFN-γ-F GCAGGTCATTCAGATGTAGCGG 181
IFN-γ-F TGTCTTCCT TGATGGTCTCCACAC
ACSL3-F GAGAGTTTGAACCCGATGGA 186
ACSL3-R TTGGCACAACAAATCCAATG
Primers for rats Sequences Product size
β-actin-F TTACTGCCCTGGCTCCTA 144
β-actin-R ACTCATCGTACTCCTGCTTG
IL-4-F CCACGGAGAACGAGCTCATC 101
IL-4-R GAGAACCCCAGACTTGTTCTTCA
IFN-γ-F CCCTCTCTGGCTGTTACTGC 149
IFN-γ-R TTTCGTGTTACCGTCCTTTTG
ACSL3-F GATTGGCTACTCTTCACC 223
ACSL3-R GAAATCTGCTCCATCTTAT